Transcription and Translation

Transcription and Translation Chapter 14 p. 263-273 Protein Structure Made up of amino acids Polypeptide- string of amino acids

20 amino acids are arranged in different orders to make a variety of proteins Assembled on a ribosome Questions to be answered today How do we get from the bases found in DNA to amino acids? How do we get from a bunch of

amino acids to proteins? Replication DNA DNA double helix unwinds DNA now single-stranded New DNA strand forms using complementary base pairing (A-T, C-G) Used to prepare DNA for cell division Whole genome copied/replicated Transcription and Translation: An Overview (aka the Central Dogma)

DNA Transcription RNA Translation Protein RNA vs. DNA

DNA Double stranded Deoxyribose sugar Bases: C,G A,T RNA Single stranded Ribose sugar

Bases: C,G,A,U Both contain a sugar, phosphate, and base. Transcription RNA forms base pairs with DNA

C-G A-U Primary transcriptlength of RNA that results from the process of transcription TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG UGCUAUGGGACU

Major players in transcription mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus

Major players in transcription RNA polymerasecomplex of enzymes with 2 functions: Unwind DNA sequence Produce primary

transcript by stringing together the chain of RNA nucleotides mRNA Processing Primary transcript is

not mature mRNA DNA sequence has coding regions (exons) and non-coding regions (introns) Introns must be removed before primary transcript is mRNA and can leave nucleus Transcription is donewhat now? Now we have mature mRNA

transcribed from the cells DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we read the code? Translation Second stage of protein production

mRNA is on a ribosome Ribosomes 2 subunits, separate in cytoplasm until they join to begin translation Large Small Contain 3 binding sites

E P A Translation Second stage of protein production mRNA is on a ribosome tRNA brings amino acids to the ribosome

tRNA Transfer RNA Bound to one amino acid on one end Anticodon on the other end

complements mRNA codon tRNA Function Amino acids must be in the correct order for the protein to function correctly tRNA lines up amino acids using mRNA code

Reading the DNA code Every 3 DNA bases pairs with 3 mRNA bases Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA

bases How many bases code for each amino acid? 1 base = 1 amino acid 41 = 2 bases = 1 amino acid 42 =

3 bases = 1 amino acid 43 = The Genetic Code ACGATACCCTGACGAGCGTTAGCTATCG UGCUAUGGGACUG Which codons code for which amino acids?

Genetic code- inventory of linkages between nucleotide triplets and the amino acids they code for A gene is a segment of RNA that brings about transcription of a segment of RNA Transcription vs. Translation Review

Transcription Process by which genetic information encoded in DNA is copied onto messenger RNA

Occurs in the nucleus DNA mRNA Translation Process by which

information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein

Recently Viewed Presentations

  • Main Title - Naesp

    Main Title - Naesp

    Literacy Education for All, Results for the Nation (LEARN) Act. Authorizes $2.5 B to create comprehensive literacy strategy for early childhood through grade 12. Districts must provide PD to incorporate literacy across content areas and targeted interventions for struggling students
  • A Feature-Based Analysis & Comparison of IT Automation Tools ...

    A Feature-Based Analysis & Comparison of IT Automation Tools ...

    A Feature-Based Analysis & Comparison of IT Automation Tools: Comparing Kaseya to <Your Tool> ... and whether it is possible to filter them or group them based on their roles (e.g., servers, workstations, laptops, windows XP, windows Vista, windows 2003...
  • Portfolio Mangement - NYU

    Portfolio Mangement - NYU

    Performance can be measured against: Benchmark portfolio Market adjusted Market model / index model adjusted Reward to risk measures such as the Sharpe measure: E (rp-rf) / p Performance Evaluation Issues Theoretically correct measures are difficult to construct Different statistics...
  • CE 201 - Statics

    CE 201 - Statics

    CE 201 - Statics Lecture 7 EQUILIBRIUM OF A PARTICLE CONDITION FOR THE EQUILIBRIUM OF A PARTICLE A particle is in EQUILIBRIUM if: it is at rest, OR it is moving with constant velocity The term "EQUILIBRIUM" is often used...
  • WHAP Exam Review 3 - Moore Public Schools

    WHAP Exam Review 3 - Moore Public Schools

    Protestant Reformation. RCC was unifying force during the Middle Ages. Martin Luther: upset with corruption of church (indulgences); believed in salvation by faith not by works, all believers are equal, can have personal relationship with God, everyone can read and...
  • Grammar Bytes

    Grammar Bytes

    Grammar Byte 6.1 Clause/Phrase: Appositive: A . noun or noun phrase that is placed after another noun or noun phrase to help identify it or to give more specific information. The appositive is set off from the sentence by a...
  • Ripasso generale - The College of New Jersey

    Ripasso generale - The College of New Jersey

    Mi chiamo Silvia Come stai? Sto abbastaza bene Come sei? Sono simpatica e carina Quanti anni hai? Ho ventun anni Dove studi? Studio all'università Che cosa studi? Ingegneria nucleare Che cosa ti piace? Mi piacciono le paste Quando esci? Esco...
  • Psychology Disorders and Treatments

    Psychology Disorders and Treatments

    -Phobias usually begin in childhood and comes in many forms-Researchers have proposed that there is a neural circuit for social phobia that includes the thalamus, amygdala, and cerebral cortex and as well as a number of neurotransmitters (especially serotonin)-With regards...